معلومة

مشكلة الفأر ميتا غلوبين مرنا


هذا هو خيط مرنا من ميتا غلوبين الماوس:

5'-ccccagauacggaauucgaau-3 '

أ) ما هو الحمض النووي الريبي الصغير (أدناه) الذي من المرجح أن ينظم التعبير عن الميتا غلوبين؟

  1. 5'-auucgaauuuucuaucugggg-3 '
  2. 5'-ggggucuaucuuuuaagcuua-3 '
  3. 5'-ccccagauacggaauucgaau-3 '
  4. 5 '-uaagcuuaaggcauagacccc-3'

ب) هذا الحمض النووي الريبي على الأرجح؟

  1. بمثابة سيرنا
  2. تمنع ترجمة ميتا غلوبين
  3. زيادة ترجمة ميتا غلوبين
  4. تساعد في نقل meta-globin mRNA مرة أخرى إلى النواة

محاولتي:

أعتقد أن A هي 2 لأن الخيط مكمل وسوف يرتبط بشكل جيد بحبلا mRNA. بالنسبة لـ B ، فأنا بين 2 و 3 ، لكن لا يمكنني اتخاذ القرار.


هناك دائمًا استثناءات ولكن يمكنك مراعاة بعض القواعد العامة.

A هو 1 أي التسلسل المكمل تمامًا (2 مكمل ولكن الاتجاه متوازي - لا يمكن أن يكون زوج القاعدة) ، ثم B سيكون 1 (siRNA). الأسباب (بعضها يعتمد فقط على القواعد العامة لتصميم siRNA):

  • يجب أن تكون siRNAs متكاملة تمامًا
  • الحجم مثالي أيضًا لـ siRNA (21nt)
  • U / A (2-3 بقايا) عند 5 'من siRNA
  • يو في المركز العاشر
  • محتوى GC 43٪ (مثالي 30-50٪)

انظر هنا للحصول على إرشادات لتصميم siRNA.


MRNA الاصطناعية المعدلة كيميائيًا (modRNA): نحو منصة تقنية جديدة لبيولوجيا القلب والأوعية الدموية والطب

على مدى العقدين الماضيين ، تم الكشف عن مجموعة من المسارات الجزيئية الجديدة التي توجه تطور قلب الثدييات والمرض. كانت القدرة على التلاعب الجيني بهذه المسارات في الجسم الحي تعتمد إلى حد كبير على توليد أنظمة نماذج الفئران المعدلة وراثيًا أو نقل الجينات الخارجية في مجموعة متنوعة من نواقل الحمض النووي (البلازميد ، والفيروسات الغدية ، والفيروسات المرتبطة بالغدة ، وقليل النوكليوتيدات المضادة للحساسية ، وما إلى ذلك). . في الآونة الأخيرة ، تم الإبلاغ عن نهج جديد للتلاعب بالبرنامج الجيني لقلب الثدييات البالغة والذي سيسمح بسرعة بالتعبير عالي الكفاءة لأي بروتين تقريبًا في القلب السليم للفأر والفئران والخنازير والرئيسيات غير البشرية وخلايا قلب الإنسان عبر توليد مرنا معدل كيميائيا (modRNA). منصة التكنولوجيا لها آثار مهمة لتحديد إشارات الباراكرين المحددة التي تدفع تكوين القلب البشري ، والمسارات التي قد تؤدي إلى تجديد القلب عبر التوليد السريع لمكتبات modRNA من عوامل paracrine للإدارة المباشرة في الجسم الحي. بالإضافة إلى ذلك ، يمكن توسيع الاستراتيجية لتشمل مجموعة متنوعة من أنسجة القلب والأوعية الدموية الأخرى والأعضاء الصلبة عبر أنواع متعددة ، وقد دعمت التحسينات الأخيرة في التكنولوجيا الأساسية التحرك نحو الدراسات البشرية الأولى للـ modRNA في العامين المقبلين. تتم مراجعة هذه التطورات الحديثة جنبًا إلى جنب مع توقعات التأثير المحتمل للتكنولوجيا لمجموعة من المشاكل الطبية الحيوية الأخرى في نظام القلب والأوعية الدموية.

حقوق النشر © 2015 Cold Spring Harbor Laboratory Press جميع الحقوق محفوظة.

الأرقام

مناهج لمعالجة الجزيئات ...

مناهج لمعالجة المسارات الجزيئية لقلب الإنسان في الجسم الحي. أ…

عامل نمو بطانة الأوعية الدموية (VEGF) ...

يوجه عامل النمو البطاني الوعائي (VEGF) modRNA التعبير عالي الكفاءة عن VEGF المفرز من ...

VEGFA modRNA يوجه نبضة ...

يوجه VEGFA modRNA نبضة تعبير عن عامل paracrine في الجسم الحي ، ...

( أ ) الأديم المتوسط ​​للقلب ...

( أ ) تؤدي سلائف الأديم المتوسط ​​للقلب إلى ظهور مجموعتين فرعيتين متميزتين من ...


لين ، سي دي ، ماربيكس ، جي & أمبير جوردون ، جي بي. J. جزيء. بيول. 61, 73–91 (1971).

Hill، M. & amp Huppert، J. بيوكيم. بيوفيس. اكتا 312, 26–35 (1970).

Furusawa، M.، Nishimura، T.، Yamaizumi، M. & amp Okada، Y. طبيعة سجية 249, 449–450 (1974).

Loyter، A.، Zakai، N. & amp Kulka، R.G. J. خلية بيول. 66, 292–304 (1975).

Maeyer-Guignard، J.، Maeyer، E. & amp Montagnier، L. بروك. ناتن. أكاد. علوم. الولايات المتحدة الأمريكية. 69, 1203–1207 (1972).

جرايسمان ، أ. شرح الخلية الدقة. 60, 373–382 (1970).

ستايسي ، دي دبليو & أمبير ألفري ، في جي. زنزانة 9, 725–732 (1976).

ديميترياديس ، ج. FEBS ليت. 86, 289–293 (1978).

ديميترياديس ، ج. الدقة الأحماض النووية. 5, 1381–1386 (1978).

Mayhew، E.، Papahadjopoulos، D.، O'Malley، J. A.، Carter، W.A & amp Vail، W. J. جزيء. فارماك. 13, 488–495 (1977).

Papahadjopoulos، D.، Vail، W. J.، Jacobson، K. & amp Poste، G. بيوكيم. بيوفيس. اكتا 394, 483–491 (1975).

وايسمان ، ج. وآخرون. بروك. ناتن. أكاد. علوم. الولايات المتحدة الأمريكية. 72, 88–92 (1975).

هيوود ، إس م. بروك. ناتن. أكاد. علوم. الولايات المتحدة الأمريكية. 67, 1782–1788 (1970).

بريتشارد ، بي إم ، بيكيانو ، دي جي ، لايكوك ، دي جي وأمبير أندرسون ، دبليو إف. بروك. ناتن. أكاد. علوم. الولايات المتحدة الأمريكية. 68, 2752–2756 (1971).

Stavnezer ، J. & amp Huang ، R. C. C. طبيعة بيول الجديدة. 230, 172 (1971).

ديميترياديس ، جي جيه ، أمبير جورجاتسوس ، ج. ج. FEBS ليت. 46, 96–100 (1974).

ديميترياديس ، جي.جيه ، أمبير جورجاتسوس ، جي جي. الدقة الأحماض النووية. 2, 1719–1726 (1975).

كريج ، آر كيه ، براون ، بي إيه ، هاريسون ، أو.س ، ماكيلريف ، دي أند كامبل ، بي إن. بيوتشيم. ج. 160, 57–74 (1976).

Laemmli، U. K. طبيعة سجية 227, 680–685 (1970).

Harris، R. & amp Ukaejiofo، E. O. Br. هيمات. 18, 229–235 (1970).

أفراميس ، س. كيمياء مناعية 6, 43–52 (1969).

Ternynck، T. & amp Avrameas، S. FEBS ليت. 23, 24–28 (1972).

Bonner، W.M & amp Laskey، R. A. يورو. J. Biochem. 46, 83–88 (1974).


نتائج

قلل ناقل التعبير (كدنا) المضاد من مستويات الجلوبين مرنا في خطوط خلايا MEL المستقرة

تم إنشاء ثلاثة خطوط خلايا MEL مستقرة تسمى ES10 و ES21 و ES22 باستخدام miniconstruct HS2γβ. لاحظنا التعبير التأسيسي لجينات γ و globin في جميع الخطوط (الشكل 1 ، الممرات 1 و 5) كما يتضح من فحوصات حماية RNase (RPAs). تم إجراء تجارب أولية لتثبيط تعبير β globin باستخدام اثنين من oligodeoxynucleotides (ODNs) ، أحدهما موجه نحو موقع الغطاء لجين β globin والثاني تجاه الذيل ، بتركيزات مختلفة. لم يكن هناك تأثير واضح على التعبير الجيني (البيانات غير معروضة). قمنا بعد ذلك باختبار ناقل التعبير pZeoβAS ، الذي يحتوي على جزء مضاد للدلالة β globin cDNA تحت سيطرة مروج SV40 للقدرة على تثبيط تعبير globin. تم نقل هذا النواقل إلى خلايا ES21 لإنشاء ثلاثة خطوط مستقرة مضادة للحساسية. نظرًا لنقص فعالية شبكات ODN ، اخترنا تحليل جزء كامل الطول globin cDNA للحصول على أقصى قدر من التأثيرات المثبطة على الرغم من وجود تماثل متسلسل بنسبة 74 ٪ بين الجينات γ و. لاحظنا انخفاضًا في مستويات mRNA لكل من و globin في اليوم 14 (الشكل 1 ، الممرات 2-4) واليوم 28 (الشكل 1 ، الممرات 6-8) لجميع الخطوط الثلاثة المضادة للحساسية. تم تحليل العديد من الخطوط المستقرة لخلايا MEL للتحكم بما في ذلك BS211 و BS212 و BS213 ، والتي تم إنشاؤها باستخدام جزء موجه نحو الشعور β globin cDNA في خلايا ES21 ، وخط التحكم السلبي pZeo ، الذي تم إنشاؤه باستخدام ناقل التعبير الأصلي pZeoSV. لم يكن هناك تغيير كبير في مستوى β أو γ globin mRNA لخطوط خلايا التحكم الأربعة (الشكل 1 ، الممرات 9-13). تم قياس مستوى نسخ الحمض النووي الريبي الناتج عن ناقل pZeoβAS باستخدام مسبار β globin بواسطة RPA في نقاط زمنية مختلفة. تم الكشف عن نصوص غلوبين antisense حتى اليوم 42 (البيانات غير معروضة) تشير إلى أن مروج SV40 استمر في إنتاج نسخ RNA مضادة المعنى على المدى الطويل لحساب التعبير الجيني globin المكبوت.

جل حماية RNase لخطوط خلايا MEL المستقرة غلوبين. تم عزل الحمض النووي الريبي من الخلايا في اليوم 14 واليوم 28 بعد العدوى. تم تهجين إجمالي الحمض النووي الريبي (2 ميكروغرام) باستخدام مجسات خاصة بأكتين الفأر (mActin) والإنسان β (hβ) والإنسان γ (hγ) (انظر المواد والطرق). يُظهر التصوير الشعاعي الذاتي نمط التعبير الجيني hβ و hγ و mActin في الخطوط التجريبية: ES21 (التحكم) وخطوط الخلايا الثابتة الثلاثة المضادة للحساسية ASB211 و ASB212 و ASB213 (الممرات 1-8). تم تحليل العديد من خطوط التحكم المستقرة بما في ذلك ES 10 (الممر 9) الذي تم إنشاؤه باستخدام بلازميد HS2γβ وحده أو بالاشتراك مع جزء β globin cDNA الموجه بالمعنى: BS211 و BS212 و BS213 (الممرات 10-12). تم إنشاء خط تحكم سلبي مع البلازميد الأصلي pZeo (الممر 13). يحتوي الممران 14 و 15 على عناصر تحكم إيجابية وسلبية (خلايا MEL غير منقولة) لتحقيقات RNA المستخدمة.

تم حساب مستويات mRNA لكل من و globin في الخطوط الثلاثة المضادة للحساسية كنسبة مقابل أكتين الفأر المصحح لرقم نسخة الجين. بالنسبة للخطوط المستقرة المضادة للحساسية ASB211 و ASB212 و ASB213 ، كان متوسط ​​عدد النسخ 0.18 و 0.15 و 0.15 على التوالي و 0.20 لخط التحكم ES21. تم تخفيض مستويات β و globin mRNA بمتوسط ​​73.9٪ و 61.6٪ (ص & lt 0.05) ، على التوالي (الجدول 1 والشكل 2) في جميع الخطوط الثلاثة المضادة للمعنى حسب اليوم 14. المستوى النسبي لـ β عكس globin mRNA (نسبة β /) انخفض بنسبة 31.8 ٪ مما يشير إلى أن الانخفاض في تخليق β globin mRNA كان أكبر من ذلك بالنسبة لـ γ globin mRNA (الجدول 2). بحلول اليوم 21 ، كانت نسبة β / 68.1 ٪ ، مما يشير إلى أنه من اليوم 14 إلى 21 كان هناك انخفاض أسرع في إنتاج β globin mRNA من γ globin mRNA. وبالمثل ، في اليومين 28 و 35 ، ظلت مستويات كل من و γ globin mRNA منخفضة ، ولكن تم تثبيط تعبير globin باستمرار بدرجة أكبر من globin (الجدولان 1 و 2). وصل الانخفاض في إنتاج β و γ globin mRNA بواسطة نسخ الحمض النووي الريبي المضاد إلى مستويات متساوية تقريبًا من تثبيط 77 ٪ بحلول اليوم 42 في الثقافة (الجدولان 1 و 2 الشكل 2). من هذه البيانات خلصنا إلى أن الناقل المضاد للدلالة يمنع كلا من التعبير الجيني و globin ، ولكن كان هناك تأثير أسرع على جين β globin.

مستويات غلوبين مرنا البشري في خطوط β غلوبين المستقرة المضادة للتحسس. تم تحليل مستويات غلوبين مرنا البشرية (ح) والإنسان γ (ح) والفأر أكتين (mActin) بواسطة RPA. يتم عرض متوسط ​​مستويات β و globin mRNA لخطوط العداد الثلاثة ASB211 و ASB212 و ASB213 كنسبة إلى mActin المصحح لرقم نسخ الجينات مقارنة بخط التحكم ES21 (تم تطبيع مستوى mRNA إلى 100٪). تمثل القيم ثلاث إلى أربع تجارب مستقلة مع الخطأ المعياري للمتوسط ​​الموضح لليوم 14 إلى اليوم 42.

انخفاض التخليق الحيوي لسلسلة غلوبين في خطوط خلايا MEL غلوبين المضادة المعنى

تم عزل البروتين الكلي في اليوم 14 من خلايا MEL غير المنقولة وخطوط ES21 و ASB211 و ASB213 المستقرة. تم تحليل مستوى التخليق الحيوي لسلسلة globin و بواسطة كروماتوجرافي سائل عالي الأداء (HPLC) والذي أظهر قممًا لسلاسل β و globin في خط ES21 مقارنةً بخلايا MEL للتحكم التي لم يتم نقلها باستخدام HS2 بلازميد (الشكل 3 أ ، ب) . أدت عمليات النقل مع ناقل pZeoβAS إلى انخفاض في ذروة β globin وزيادة في ذروة γ globin (الشكل 3 ج). لاحظنا انخفاضًا بنسبة 80 ٪ و 73 ٪ في تخليق سلسلة غلوبين الإنسان في خطوط ASB211 و ASB213 ، على التوالي (الشكل 4) ، ومع ذلك ، زاد التخليق الحيوي لسلسلة غلوبين γ بمتوسط ​​233 ٪ و 802 ٪ ، على التوالي ، في خطي مضاد المعنى. على الرغم من انخفاض مستويات γ mRNA في اليوم 14 ، فقد زاد التخليق الحيوي لسلسلة γ بشكل ملحوظ. تتمثل إحدى الآليات المحتملة لهذه الملاحظة في حدوث تغيير في معدل ترجمة γ globin mRNA استجابةً للانخفاض السريع في مستويات globin mRNA بحلول اليوم 14 في الخطوط المضادة للحساسية.

تتبع HPLC لتخليق سلسلة غلوبين β و γ. تم عزل البروتين الكلي في اليوم 14 وتم تحديد كمية سلاسل globin البشرية (hβ) و (hγ) للتحكم ES21 (اللوحة ب) وخط ASB211 المضاد للمعنى (اللوحة ج) مقارنة بالتحكم في خلايا MEL غير المنقولة (اللوحة أ). لاحظ انخفاض سلاسل β globin وزيادة التخليق الحيوي لسلسلة globin في خط ASB211 المضاد (اللوحة ج) Mα ، سلاسل غلوبين الماوس α mβ ميج ، سلاسل غلوبين رئيسية للماوس.

تخليق سلسلة Globin في وجود ناقل التعبير pZeoβAS. تم عزل البروتين الكلي في اليوم 14. كان هناك انخفاض في سلسلة globin (h) وزيادة التخليق الحيوي لسلسلة globin (h) في خطوط الخلايا ASB211 و ASB213 MEL التي تم إنشاؤها باستخدام ناقل pZeoβAS مقارنة بمستويات سلسلة و globin في ES21. تم تطبيع التخليق الحيوي لسلسلة Globin إلى 100 ٪ لخط التحكم ES21. تمثل البيانات متوسط ​​القيم لتجربتين مستقلتين لكل سطر ثابت.

انخفاض مستويات الجلوبين مرنا في مزارع الكريات الحمر الأولية

تم نقل ناقل تعبير غلوبين المضاد للدلالة ، pZeoβAS ، إلى خلايا وحيدة النواة في الدم المحيطي معزولة عن مرضى الخلايا المنجلية الطبيعية. تم إجراء RPA لتقدير مستويات mRNA لجينات γ و غلوبين كنسبة إلى نازعة هيدروجين الغليسيرالديهيد -3 فوسفات (GAPD) بعد 21 يومًا في الثقافة. لاحظنا زيادة في mRNAs β و globin الأساسي للعينات التي تم الحصول عليها من مرضى الخلايا المنجلية مقارنة مع الأشخاص العاديين (الشكل 5 أ ، الممرات 1 و 3). قد يكون هذا بسبب الزيادة في نشاط نخاع العظم وزيادة عدد الخلايا السلفية المبكرة في عينات الخلايا المنجلية التي لاحظها الباحثون الآخرون .21 وبالمثل لتلك التي لوحظت في الخطوط المستقرة لخلايا MEL المضادة للحساسية ، انخفضت مستويات globin mRNA في أسلاف الكريات الحمر المنقولة بـ pZeoβAS (الشكل 5 أ ، الممران 2 و 4). بالمقارنة مع مزارع التحكم (أسلاف الكريات الحمر المنقولة بالبلازميد الأصلي pZeoSV) ، انخفض إنتاج β و γ globin mRNA بمتوسط ​​83٪ و 67٪ (ص & lt 0.05) ، على التوالي ، لكل من أسلاف الكريات الحمر الطبيعية والمنجلية (الشكل 5 ب ، ج). بالإضافة إلى ذلك ، انخفضت نسبة β / mRNA بنسبة 63٪ للطبيعي و 77٪ للأسلاف المنجلية مما يشير إلى أن الانخفاض في تخليق β globin mRNA كان أكبر بكثير من γ globin ، نتيجة مماثلة لتلك التي لوحظت لخطوط خلايا MEL المستقرة . علاوة على ذلك ، فإن نسخ RNA العادية β globin antisense التي تنتجها pZeoβAS تثبط جين غلوبين متحولة في العينات المأخوذة من مرضى الخلايا المنجلية.

مستويات Globin mRNA في مزارع الكريات الحمر الأولية تعامل بنصوص الحمض النووي الريبي المضاد للتردد. تم نقل الخلايا أحادية النواة في الدم المحيطي باستخدام نواقل pZeoβAS أو pZeoSV باستخدام نهج العدوى الدهنية. كان ناقل pZeoSV بمثابة عنصر تحكم سلبي. NZ ، أسلاف طبيعية مع pZeoSV NA ، أسلاف طبيعية مع pZeoβAS SZ ، أسلاف منجلية مع pZeoSV SA ، أسلاف منجلية مع pZeoβAS. يتم عرض هلام تمثيلي لـ RPA من إحدى العينات الأربع المختبرة في اللوحة أ. لاحظنا انخفاضًا في شدة إشارة و غلوبين لعينات الخلايا الطبيعية والمنجلية (الممرات 2 و 4). يتم عرض بيانات الفسفوريمر الكمية في اللوحات (ب) و (ج). تم تطبيع مستويات (hβ) و γ (hγ) globin mRNA إلى 100 ٪ لتجارب التحكم مع ناقل pZeoSV (NZ و SZ). لاحظ الانخفاض الأكثر أهمية في مستويات β globin mRNA مقارنة مع globin لكل من عينات الخلايا الطبيعية وعينات الخلايا المنجلية.


مناقشة

لقد طورنا طريقة Bayesian تسمى DecontX لتقدير النسبة المئوية للتلوث المتبادل داخل كل خلية بسبب الحمض النووي الريبي المحيط أو عوامل تجريبية أخرى. في نموذجنا ، يتم التعامل مع كل خلية على أنها مزيج من التوزيعات متعددة الحدود على الجينات ، واحدة من مجموعة الخلايا الأصلية والأخرى من التلوث. لكل مجموعة من الخلايا ، يتم تعريف توزيع التلوث على أنه مزيج من تعداد الجينات من مجموعات الخلايا الأخرى. من المرجح أن تساهم الجينات التي يتم التعبير عنها بشكل كبير (أي لديها عدد أكبر من UMI) في مجموعات الخلايا الأخرى في التلوث في مجتمع الخلايا الحالي. لذلك ، سيكون لهذه الجينات احتمالات أعلى نسبيًا في توزيع التلوث مقارنةً بتوزيع التعبير في مجموعة الخلايا الأصلية ، ومن المرجح أن يطلق على عدد هذه الجينات اسم "التلوث". يمكن التعبير عن أنواع معينة من جينات التدبير المنزلي ، مثل جينات ترميز البروتين الريبوسومي ، بشكل كبير عبر العديد من مجموعات الخلايا ، وبالتالي سيكون لها احتمالية عالية تظهر في كل من مجموعات الخلايا الأصلية وتوزيعات التلوث. في هذه الحالة ، يُطلق على تعداد هذه الجينات في الغالب اسم "أصلي" بافتراض أن النسبة الإجمالية للتلوث المقدر في تلك الخلية منخفضة نسبيًا أيضًا. أظهرنا دقة DecontX من خلال إظهار أنه كان قادرًا على تقدير النسبة المئوية للنصوص الملوثة الخارجية في مجموعة بيانات خليط الفأر البشري. علاوة على ذلك ، بعد تقدير وإزالة النصوص الملوثة في بيانات 4K PBMC ، فإن ملفات تعريف جينات العلامات الرئيسية لكل مجموعة سكانية فرعية تشبه بشكل أفضل تلك الموجودة في PBMCs المنقاة والمفرزة.

لاحظنا أن أنواع الخلايا ذات الوفرة الإجمالية للـ mRNA وانتشارها داخل مجموعة البيانات من المرجح أن تساهم في التلوث في أنواع الخلايا الأخرى. على سبيل المثال ، في مجموعة بيانات خليط الفأر البشري ، كان للخلايا البشرية محاذاة UMIs بشكل فريد في المتوسط ​​أكثر من خلايا الماوس. لذلك ، ساهمت الخلايا البشرية في المزيد من القراءة في الحمض النووي الريبي المحيط وأدت إلى المزيد من التلوث في خلايا الفئران. في بيانات 4K PBMC ، كانت الخلايا الوحيدة هي ثاني أكثر أنواع الخلايا شيوعًا ولديها أعلى إجمالي عدد من تعداد UMI في المتوسط. بالإضافة إلى ذلك ، كانت الجينات المرتبطة بالوحيدات مثل LYZ و S100A8 و S100A9 هي أكثر الجينات الواسمة الخاصة بنوع الخلية المعبر عنها بشكل كبير ، وبالتالي ساهمت بشكل أكبر في التلوث في أنواع الخلايا الأخرى مقارنة بالعلامات من المجموعات السكانية الأخرى. تظهر هذه النتائج أن توزيعات التلوث في كل خلية ستعتمد على أنواع الخلايا الأخرى في الفحص بالإضافة إلى مستوى التعبير عن جينات معينة في تلك الأنواع من الخلايا.

في بعض الحالات ، لم يكن DecontX قادرًا على إزالة التعبير الشاذ تمامًا لعلامات نوع الخلية. على سبيل المثال ، لا يزال 43.03٪ من الخلايا القاتلة الطبيعية في 4K PBMC تظهر تعبيرًا عن علامات الخلايا التائية. أحد التفسيرات المحتملة هو أن بعض الخلايا في مجموعة البيانات هذه كانت في الواقع خلايا NKT وتشترك حقًا في ميزات التعبير من مجموعات الخلايا NK و T [19]. عامل آخر هو أنه بالنسبة لمجموعات الخلايا التي تشترك في أوجه تشابه كبيرة في أنماط التعبير الجيني ، فإن DecontX يميل إلى أن يكون محافظًا ويعامل غالبية هذه التهم على أنها تعبير أصلي بدلاً من تلوث. بشكل عام ، نعتقد أن هذا السلوك مرغوب فيه ، لذلك لا يتم إزالة التباين البيولوجي الحقيقي بين أنواع الخلايا. تم تقدير الخلايا المقدر أنها شديدة التلوث بواسطة DecontX في 4K PBMC على أنها مزدوجة بواسطة خوارزميات مستقلة. لذلك ، قد تكون مستويات التلوث العالية مفيدة أيضًا كمعيار لمراقبة الجودة لاستبعاد الخلايا. بالإضافة إلى ذلك ، يُظهر تقدير DecontX لمجموعات البيانات المعيارية أن 10X Chromium لديه أقل تلوث ، بينما CEL-seq2 لديه أعلى تلوث. أظهر CEL-seq2 ترددات أعلى بكثير للتعيينات الجينية والجينية مقارنة بطرق scRNA-seq الأخرى [20]. على الرغم من أن بروتوكول SORT-seq مشابه لـ CEL-seq2 ، إلا أنه استخدم زيت تسرب البخار لمنع التبخر [7] مما أدى إلى تقليل التلوث بشكل عام في تحليلنا.

من خلال استخدام الأعداد الأولية لتقدير التوزيعات متعددة الحدود ، يلغي DecontX التباين المحتمل الذي يمكن تقديمه بواسطة طرق التطبيع المختلفة. أحد القيود هو أن تسميات كتلة الخلية مطلوبة مسبقًا. بينما نستخدم Celda تلقائيًا لتحديد مجموعات الخلايا إذا لم يتم توفير أي منها ، يمكن استخدام أي نهج تجميع خلايا سريع. نظرًا لأن توزيع التلوث لكل مجموعة خلية مشتق من جميع المجموعات السكانية الأخرى الموجودة في مجموعة البيانات ، فقد يكون من الأفضل أحيانًا استخدام تسميات أوسع لمجموعات الخلايا. على سبيل المثال ، قد يساعد تضمين جميع الخلايا التائية في مجموعة واحدة بدلاً من معالجة المجموعات السكانية الفرعية للخلايا التائية الفردية كمجموعة فرعية منفصلة في التخفيف من التعداد الخاص بالخلايا التائية في حساب توزيعات التلوث لجميع الخلايا التائية.


وصف مفصل

تؤوي الفئران Ai140D الأليل الشرطي TIGRE-Ins-TRE2-LSL-EGFP-Ins-CAG-LSL-tTA2 ، المصمم بمحفز TRE2 ، loxP-محاطة بشريط STOP وتسلسل EGFP ، ثم مروج CAG ، lox2272-محاطة بإيقاف كاسيت وتسلسل tTA2. قبل التعرض لـ Cre recombinase ، تم تصميم هذا الأليل بحيث يحتوي على كاسيتين floxed-STOP يمنعان التعبير عن جينات المصب (EGFP و tTA2). عندما يتم تربيتها للفئران التي تعبر عن recombinase ، فإن النسل الناتج سيحتوي على كل من أشرطة floxed-STOP المحذوفة في كري- التعبير عن الخلايا / الأنسجة - مما يؤدي إلى مضان EGFP وتعبير ttA2. نظرًا لوضعه في اتجاه مجرى مروج TRE2 ، فإن الإدخال اللاحق للتتراسيكلين (أو الدوكسيسيكلين التناظري [دوكس]) سوف يقلل / يزيل تعبير EGFP.

على وجه التحديد ، أفاد المحقق المتبرع أنه في حالة عدم وجود Cre ، فإن الفئران متغايرة الزيجوت لـ Ai140D لا تظهر أي تألق ، وتكون قابلة للحياة وخصبة مع عدم وجود أي تشوهات جسدية أو سلوكية جسيمة. يكشف التلقيح المناعي المضاد لـ GFP عن بعض تعبيرات الخلفية في القشرة والحصين ، ولكن هذا أقل بعدة أضعاف من المستويات التي لوحظت بعد التعرض لـ recombinase Cre. اعتبارًا من سبتمبر 2018 ، كانت تجربة مختبر جاكسون هي أن الفئران متماثلة اللواقح قابلة للحياة وخصبة.
عندما يتم تربية الفئران Ai140D بخطوط Cre-driver لإنشاء حيوانات معدلة وراثيًا مزدوجة (EGFP + tTA2 + / Cre +) ، تظهر الخلايا التي تعبر عن كل من tTA2 و Cre مضان EGFP قوي / مشرق. تم تمييز التوهين الذي يحفزه dox لتعبير EGFP - تم قمع مضان EGFP تمامًا بعد أسبوعين من علاج dox.
تم استخدام العديد من خطوط محرك Cre مع أنماط تعبير محددة مع Ai140D - مما أدى إلى نسل متحور مزدوج مع عدم وجود مشاكل في الجدوى (بما في ذلك C57BL / 6J-congenic Etv1-CreERT2 و Sst-IRES-Cre (انظر الأسهم رقم 013048 و 013044). ومع ذلك ، فإن الفئران المتغايرة الزيجوت المزدوجة Emx1-IRES-CreAi140D قد خفضت حجم المخ وظهرت تنكسًا عصبيًا واضحًا في جميع الحقول الفرعية للحصين (انظر المخزون رقم 005628). بالإضافة إلى ذلك ، فإن تجربتهم هي الفئران المتغايرة الزيجوت المزدوجة Gad2-CreAi140D التي أظهرت الفتك الجنيني (انظر المخزون رقم 019022) ) - هذا مشابه لما اكتشفوه من قدرة مميتة مزدوجة متغايرة الزيجوت باستخدام نفس محرك Gad2-Cre مع أليل Ai139D أو Ai148D (مخزون رقم 030219 أو 030328).

حتى الآن (مارس 2017) ، لم يقم المحقق المتبرع بتقييم التعبير المستحث بـ Cre-inducible Ai140D في أنسجة أخرى غير الدماغ.


وافقت إدارة الغذاء والدواء الأمريكية على أول اختبار لـ CRISPR لتصحيح الخلل الجيني الذي يسبب مرض فقر الدم المنجلي

في عام 2014 ، بعد عامين من اختراعها الحائز على جائزة نوبل لتعديل الجينوم CRISPR-Cas9 ، اعتقدت جينيفر دودنا أن التكنولوجيا ناضجة بما يكفي لمعالجة اضطراب وراثي مدمر ، مرض فقر الدم المنجلي ، الذي يصيب ملايين الأشخاص حول العالم ، معظمهم من أصل أفريقي. حوالي 100000 شخص أسود في الولايات المتحدة مصابون بهذا المرض.

حشدوا الزملاء في معهد الجينوم المبتكر (IGI) الجديد آنذاك - وهو تعاون بحثي مشترك بين جامعة كاليفورنيا ، بيركلي ، وجامعة كاليفورنيا في سان فرانسيسكو - سعوا لإصلاح الطفرة المفردة التي تجعل خلايا الدم الحمراء تتشوه وتسد الشرايين ، مما يسبب ألمًا مؤلمًا الألم وغالبا الموت. عادةً ما تتضمن العلاجات المتاحة اليوم عمليات نقل دم منتظمة ، على الرغم من أن عمليات زرع نخاع العظم يمكن أن تعالج أولئك الذين يمكنهم العثور على متبرع مطابق.

بعد ست سنوات من العمل ، تمت الموافقة الآن على هذا العلاج التجريبي للتجارب السريرية من قبل إدارة الغذاء والدواء الأمريكية ، مما يتيح إجراء الاختبارات الأولى على البشر للعلاج المستند إلى CRISPR لتصحيح الطفرة في جين بيتا غلوبين المسؤول عن المنجل. مرض الخلية. بيتا غلوبين هو أحد البروتينات الموجودة في مركب الهيموغلوبين المسؤول عن حمل الأكسجين في جميع أنحاء الجسم.

التجارب ، التي من المتوقع أن تستغرق أربع سنوات ، سيقودها أطباء في مستشفى UCSF Benioff للأطفال في أوكلاند ومركز أبحاث الخلايا الجذعية العريضة بجامعة كاليفورنيا ، الذين يخططون للبدء هذا الصيف لتسجيل ستة بالغين وثلاثة مراهقين يعانون من مرض فقر الدم المنجلي الحاد.

سيلعب مختبر التشخيص السريري التابع لـ IGI ، والذي تم بناؤه تحت قيادة Doudna لتوفير اختبار COVID-19 المجاني لمجتمع بيركلي ، دورًا رئيسيًا في الدعم التحليلي للتجربة من خلال تطوير التشخيصات لمراقبة رفاهية المريض وتتبع كفاءة علاج او معاملة.

قال دودنا ، أستاذ البيولوجيا الجزيئية والخلوية والكيمياء في جامعة كاليفورنيا في بيركلي ، وباحث في معهد هوارد هيوز الطبي: "نحن متحمسون للعمل نحو علاج يمكن أن يكون متاحًا وبأسعار معقولة للمرضى في جميع أنحاء العالم". "يعد إطلاق هذه التجربة خطوة أولى أساسية على هذا المسار."

يقود التجربة السريرية الدكتور مارك والترز ، أستاذ طب الأطفال في جامعة كاليفورنيا في سان فرانسيسكو ومدير الأسرة الأردنية لبرنامج زراعة الدم والنخاع في مستشفى أوكلاند للأطفال بينيوف للأطفال. (حقوق الصورة لـ UCSF)

نجحت تجارب أخرى في استخدام تقنية CRISPR-Cas9 لإخراج الجين الذي يثبط جين الهيموجلوبين الجنيني ، والذي يتم إيقافه عادةً عند البشر. تعمل هذه التقنية على إعادة إيقاظ جين الجنين ، وقد خففت أعراض فقر الدم المنجلي لدى ثلاثة مرضى على الأقل.

التجربة الجديدة عبارة عن إدخال جيني: يستخدم الباحثون تقنية CRISPR-Cas9 لاستبدال جين بيتا غلوبين المعيب بنسخة تم إصلاحها ، بهدف تكوين خلايا دم حمراء طبيعية للبالغين وعلاج هذا الاضطراب.

قال الدكتور مارك والترز ، أستاذ طب الأطفال في UCSF و الباحث الرئيسي في التجربة السريرية ومشروع تحرير الجينات. "إذا تم تطبيق هذا بنجاح على المرضى الصغار ، فمن المحتمل أن يمنع مضاعفات المرض التي لا رجعة فيها."

هناك تجربة سريرية أخرى تستخدم أيضًا تقنية كريسبر لتصحيح طفرة الخلايا المنجلية مباشرةً ، ولكن بنهج مختلف قليلاً ، ومن المقرر أن تبدأ هذا العام ، تديرها جرافيت بيو بناءً على بحث من مختبر ماثيو بورتيوس & # 8217 في جامعة ستانفورد.

المرضى هم المتبرعون بالخلايا الجذعية الخاصة بهم

تتطلب هذه التقنية ، كما هو الحال مع النهج البديل الذي يعيد إيقاظ الهيموجلوبين الجنيني ، أن يتم حصاد بعض الخلايا الجذعية المكونة للدم للمريض - خلايا نخاع العظم التي تولد جميع خلايا الدم الحمراء في الجسم - لتعديل الجينات خارج الجسم. بعد إزالة هذه الخلايا ، يتم تدمير النخاع العظمي المتبقي بالعلاج الكيميائي للسماح بنمو الخلايا الجذعية التي تم إصلاحها وإعادة دمجها.

يشارك الدكتور دونالد كوهن ، الأستاذ المتميز في علم الأحياء الدقيقة وعلم المناعة وعلم الوراثة الجزيئي وطب الأطفال وعلم الأدوية الجزيئي والطب في كلية ديفيد جيفن للطب بجامعة كاليفورنيا في لوس أنجلوس وعضو في مركز أبحاث الخلايا الجذعية العريضة بجامعة كاليفورنيا في لوس أنجلوس ، في العديد من تجارب العلاج الجيني لأمراض مثل SCID ومرض فقر الدم المنجلي. (حقوق الصورة لجامعة كاليفورنيا في لوس أنجلوس)

والترز ، وهو أيضًا مدير عائلة الأردن لبرنامج زرع الدم والنخاع في مستشفى UCSF Benioff للأطفال في أوكلاند ، سيعمل مع الطبيب والعالم في جامعة كاليفورنيا في لوس أنجلوس الدكتور دونالد كون ، الذي طور علاجات جينية للعديد من اضطرابات الدم الوراثية ، بما في ذلك العلاج. لشكل من أشكال نقص المناعة المشترك الشديد (SCID). يقود كوهن أيضًا تجربة سريرية لنوع مختلف من العلاج الجيني لمرض الخلايا المنجلية ، والذي يتضمن إضافة جين جديد إلى الخلايا الجذعية للمرضى للتغلب على طفرة الخلايا المنجلية.

قال كون ، الأستاذ المتميز في علم الأحياء الدقيقة وعلم المناعة وعلم الوراثة الجزيئي وطب الأطفال وعلم العقاقير الجزيئي والطب في كلية ديفيد جيفن للطب بجامعة كاليفورنيا في لوس أنجلوس: "يسمح العلاج الجيني وتحرير الجينات لكل مريض بالعمل كمتبرع للخلايا الجذعية" عضو في مركز أبحاث الخلايا الجذعية العريضة بجامعة كاليفورنيا. "من الناحية النظرية ، يجب أن تكون هذه الأساليب أكثر أمانًا من عملية زرع من شخص آخر ويمكن أن تصبح متاحة عالميًا لأنها تلغي الحاجة إلى العثور على الإبرة في كومة قش متبرع مطابق للخلايا الجذعية."

سيقود كوهن أنشطة المختبرات والتجارب السريرية في جامعة كاليفورنيا وسيتولى الإشراف على جميع عمليات تصنيع المنتج الدوائي ، المسمى CRISPR_SCD001 ، للتجربة السريرية. تم تمويل العمل قبل السريري لتطوير هذا العلاج من قبل معهد كاليفورنيا للطب التجديدي والمبادرة الوطنية للقلب والرئة والدم التي يقودها معهد Cure Sickle Cell ومؤسسة Doris Duke Charitable Foundation.

فيودور أورنوف ، مدير IGI للتكنولوجيا والترجمة وأستاذ البيولوجيا الجزيئية والخلوية بجامعة كاليفورنيا في بيركلي ، سوف يشرف على أنشطة المعلوماتية الحيوية والجينوميات للدراسة.

قال أورنوف: "من الجدير بالذكر أن هذه التجربة الجديدة تأتي من كونسورتيوم من المؤسسات الأكاديمية غير الهادفة للربح التي تم تحفيزها برؤية طويلة الأجل لعلاج المرض من خلال حل ميسور التكلفة يمكن أن يفيد كل من يحتاج إليه على مستوى العالم".

سيشرف فيودور أورنوف ، مدير التكنولوجيا والترجمة في معهد IGI ، على أنشطة المعلوماتية الحيوية وعلم الجينوم للتجربة السريرية. (تصوير كيجان هاوسر)

ينتج مرض الخلايا المنجلية عن تغيير واحد في شفرة الحمض النووي لجين بيتا غلوبين. تستخدم التجربة الجديدة نوكلياز CRISPR-Cas9 - وهو بروتين Cas9 مجمّع بالكامل ويوجه تسلسل الحمض النووي الريبي الذي يستهدف المنطقة المعيبة من جين بيتا غلوبين ، مصحوبًا بجزء قصير من الحمض النووي يشفر التسلسل الصحيح - لتحفيز إصلاح الطفرة المنجلية عن طريق الاستعاضة جزء الحمض النووي الطبيعي للجزء غير الطبيعي. في هذا النهج ، يتم علاج خلايا الدم الجذعية للمريض أولاً بنبضات كهربائية تخلق مسامًا في أغشيتها. تسمح هذه المسام لمنصة CRISPR-Cas9 بدخول الخلايا الجذعية والانتقال إلى نواتها لتصحيح طفرة الخلايا المنجلية.

قال والترز: "الهدف من هذا الشكل من العلاج بتحرير الجينوم هو تصحيح الطفرة في عدد كافٍ من الخلايا الجذعية ، بحيث يصحح الدم الناتج في الدورة الدموية خلايا الدم الحمراء". "استنادًا إلى خبرتنا في عمليات زرع نخاع العظم ، نتوقع أن تصحيح 20٪ من الجينات يجب أن يكون كافيًا للتنافس على الخلايا المنجلية الأصلية وله فائدة سريرية قوية."

يستخدم بروتوكول التصنيع النهائي طريقة خالية من الفيروسات لتحرير خلايا الدم الجذعية وتم التحقق من صحتها في دراسات السلامة / علم السموم قبل السريرية التي أجريت بعد التشاور مع إدارة الغذاء والدواء.

علاجات كريسبر المستقبلية

بينما يأخذ أطباء جامعة كاليفورنيا علاج كريسبر الحالي في التجارب السريرية ، يعمل علماء معهد IGI على تحسين التقنية بحيث يمكن في النهاية تصحيح طفرة الخلايا المنجلية داخل الجسم ، دون إزالة الخلايا الجذعية أو تدمير نخاع العظام. نظرًا لأن نخاع العظام ينتج أيضًا خلايا الدم البيضاء التي تحمينا من الأمراض ، فإن تدميرها يثبط جهاز المناعة ويعرض المرضى لخطر الإصابة بالعدوى أو حتى السرطان حتى تتكاثر الخلايا الجذعية المصححة والمُصححة وتتكاثر.

ينتج مرض الخلايا المنجلية عن طفرة في جين بيتا غلوبين تجعل خلايا الدم الحمراء تتشوه إلى شكل منجل (في المقدمة) مقارنة بالشكل الدائري الطبيعي الذي يظهر في الخلفية. تسد الخلايا المنجلية الشرايين ، مما يؤدي إلى ألم شديد وتلف في الأعضاء. (حقوق الصورة لمعهد الجينوم المبتكر ، جامعة كاليفورنيا في بيركلي)

& # 8220 حاليًا ، نقوم بعلاج خارج الجسم الحي ، حيث يتم إخراج الخلايا من نخاع العظام لتصحيح الطفرة خارج الجسم ، & # 8221 قال روس ويلسون ، مدير التوصيل العلاجي IGI & # 8217s. & # 8220 ولكن خلال هذا الوقت - قد يستغرق شهورًا - تمتلئ النخاع العظمي مرة أخرى. نتيجة لذلك ، عندما يحين وقت حقن الخلايا المصححة ، يجب أن يخضع المريض للعلاج الكيميائي العدواني الذي يزيل النخاع العظمي ويسمح لتلك الخلايا المصححة بالعثور على منزل. & # 8221

يشعر ويلسون بالتفاؤل بأنه هو وعلماء IGI يمكنهم إيجاد طريقة لإرسال علاج CRISPR مباشرةً إلى نخاع العظام داخل الجسم ، باستخدام الأجسام المضادة لتوجيه إنزيم كريسبر إلى الخلايا الجذعية الصحيحة. العلماء الآخرون ، الذين يستخدمون الفيروسات المهندسة أو القطرات الدهنية - الجسيمات النانوية الدهنية - لنقل إنزيم كريسبر إلى الجسم ، فشلوا حتى الآن.

“The molecule we are trying to deliver is physically smaller — an eighth the diameter of the nanoparticles other people try to deliver to the bone marrow — and this could provide big benefits,” he said. “Our self-delivering enzyme should be able to reach the bone marrow.”

Graphic representation of CRISPR-Cas9 repairing the mutation in the gene that causes sickle cell disease (shown in light blue). (UC Berkeley image courtesy of Innovative Genomics Institute)

Whatever the successful strategy, either ex vivo or in vivo, the CRISPR platform developed for sickle cell disease could transform gene therapy for other diseases.

“That is the IGI vision: first sickle cell, but our efforts will have a ripple effect to enable cures for blood disorders in general, like beta thalassemia, as well as diseases of the immune system,” he said. “The hematopoietic stem cell is the seed for the entire immune system, so all blood disorders can theoretically be cured by a stem cell therapy like this.”


خلفية

The domain of chicken beta-globin genes is located on chromosome 1 and has a length of approximately 33 kb. It includes a cluster of four beta-globin genes: ρ (HBG1), β ح (HBE1), β أ (HBG2) و Ε (HBE) and several distant regulatory regions, which are marked with sites of hypersensitivity to DNase I (HS) and are necessary for the regulation of transcription, replication and chromatin status of the domain[1, 2]. The locus control region of the domain (LCR) is located upstream of the embryonic β-globin gene ρ and is composed of three blocks co-localizing with the erythroid cell-specific HSs 1 to 3[3, 4]. A constitutive HS4 located upstream of the LCR marks the position of the well-studied CTCF-dependent (CTCF ‐ СССTC-binding protein factor) insulator[5–9]. The CTCF-dependent enhancer-blocking element is also located at the downstream end of the domain in the area marked by the so-called 3′ constitutive HS[10, 11]. In addition to the LCR, the domain also possesses an internal enhancer (β/Ε-enhancer), which is located between the genes β أ و Ε and is believed to contribute to the control of the activity of both genes[12–14]. The partitioning of tasks between the LCR and the β/Ε-enhancer is not quite clear. The results of experiments with transgenic mice carrying the chicken β-globin gene domain[4] suggested that the expression of one of the embryonic genes (ρ) is controlled by the LCR, while the expression of the other embryonic gene (Ε) is controlled by the β/Ε-enhancer. In addition, both regulatory elements appeared to be necessary for the correct developmental expression of the adult β-globin genes[3]. The domain of the chicken β-globin gene represents one of the best-studied genomic areas in higher eukaryotes[15]. This domain possesses all of the characteristic features of the so-called closed or strong chromatin domains[16, 17], which change the pattern of sensitivity to DNase I in a cell lineage-specific fashion. Detailed studies of the distribution of different histone modifications along the domain have contributed much to the present knowledge about the histone code[18, 19]. Nevertheless, the mechanisms of transcriptional switching of chicken β-globin gene expression remain poorly understood[15]. The developmental switching of globin gene transcription is typical for all vertebrate organisms[2]. In chickens, the first molecules of hemaglobin appear in embryonic erythroblasts 32 h after fertilization[20]. The beta-chains of the hemaglobin represent the products of genes ρ و Ε, which are transcribed from the 2 nd to the 5 th day of the embryonic development. After the 5 th day a new population of erythroid cells expressing the genes of fetal and adult globins β Н و β أ يبدو. These cells gradually replace the embryonic-type erythroblasts that express genes 1ρ و Ε[21]. In erythroblasts of adult lineage, the transcription of embryonic β-type globin genes is repressed.

Analysis of β-globin mRNA levels in chicken 3-day and 9-day embryonic red blood cells. The vertical axis shows the relative amounts of β-globin gene primary transcripts, as determined by RT-qPCR analysis of RNA samples prepared from the blood of 3- and 9-day old chicken embryos. (أ) Normalization of data to the level of β-actin mRNA. (ب) Normalization of data to the amount of cells used for RNA preparation. The amounts of β-globin gene transcripts detected in different RNA samples were normalized to the number of cells used for preparation of these RNA samples. The amount of the most abundant transcript (ρ-transcript in 3-day RBCs) was set as 100 relative units and the other data were normalized to this value. The error bars represent the S.E.M. for two independent experiments.

Recent studies of the spatial configuration of the mouse and human β-globin gene domain suggest that in erythroid cells, all regulatory elements of the domain become assembled into a common activation complex (the ACH) where the promoters of different globin genes are recruited in a developmental stage-specific fashion[22–24].

In the present work, we have analyzed the spatial configuration of the chicken β-globin gene domain in circulating red blood cells (RBCs) both before (3-day RBCs) and after (9-day RBCs) the β-globin switching. Using the quantitative chromosome conformation capture assay (3C-qPCR)[25, 26], we have demonstrated that the switching of chicken β-globin gene expression correlates with prominent changes in the spatial configuration of the domain. However, the observed spectrum of changes does not perfectly fit the simplistic model that postulates that only the transcriptionally active genes are recruited to the ACH.


المواد والأساليب

Production of ivt mRNA

PCR DNA fragments with a modified T7 promoter sequence (TAA TAC GAC TCA CTA TAA GG) and an eiF4G aptamer (ACT CAC TAT TTG TTT TCG CGC CCA GTT GCA AAA AGT GTC G) followed by a codon- optimized firefly luciferase-coding gene (a synthetic gene purchased from Blue Heron Bio) or ZsGreen gene (Clontech) and terminated by either the sequence TAA or 5’ GAGAGCTCGCTTTCTTGCTG 3’ or a tandem repeat of the beta-globin 3’ UTR 14 were used as matrices for mRNA production with a HiScribe™ T7 mRNA Kit (New England Biolabs). The nucleotide mixture consisted of 8 mM CleanCapTM (a newly available CAP1 analogue), ATP, GTP, either CTP or 5mCTP and either UTP or N1-methyl pseudouridine (1) triphosphate (all from TriLink) at a final volume of 20 microlitres.

After incubation for 3 hours at 37°C, 80 microlitres of a solution containing 10 microlitres of 10x buffer, 3 microlitres of poly (A) polymerase, 1 microlitre of DNase and 1 microlitre of RNasin (all from New England Biolabs) were added. The reaction was incubated for 3 hours before the addition of 50 microlitres of 8M LiCl, cooling at -20°C for 30 minutes and centrifugation at 15000 rpm for 15 minutes. Supernatants were removed, and 200 microlitres of 75% ethanol was added. After a 10 minute centrifugation at 15000 rpm, the supernatants were discarded, and the RNA pellets were dried in a “Speed-Vac”. RNAs were then resuspended in water, and the concentration measured using a Nanodrop was adjusted to 1 microgram per microlitre. Quality and integrity of ivt mRNAs were checked using agarose gel electrophoresis. The RNAs were stored at -20°C.

Cells and Transfection

Human embryonic kidney (HEK) cells and CT26 mouse colon carcinoma cells were maintained in RPMI medium (Thermo Fisher Scientific) containing 10% foetal calf serum (FCS) and 0.2% antimicrobial reagent Normocin (InvivoGen). Human peripheral mononuclear blood cells (PBMCs) and mouse splenocytes were obtained from peripheral blood from healthy donors and wild type C57Bl/6 or BALB/c mice, respectively, using centrifugation with Ficoll. For Luciferase experiments, transfection of tumour cells (CT26 or HEK) was performed with 100 000 tumour cells per well in 100 microlitres of RPMI medium supplemented with 10% FCS and 0.2% antimicrobial reagent Normocin (Invivogen) by adding a mixture of 20 ng of mRNA in 0.5 microlitres of Opti- MEM (Thermo Fisher Scientific) and 40 ng of the lipofectamine transfection reagent MessengerMAX (Thermo Fisher Scientific) in 0.5 microlitres of Opti-MEM to each well.

Transfection of non-transformed cells (PBMCs or splenocytes) was performed with 1 million cells per well in 100 microlitres of RPMI medium supplemented with 10% FCS and 0.2% antimicrobial reagent Normocin (Invivogen) by adding a mixture of 200 ng of mRNA in 5 microlitres of Opti-MEM and 400 ng of MessengerMAX in 5 microlitres of Opti-MEM to each well. Luciferase activity was recorded one day after transfection by adding 25 microlitres of Bright-Glo luciferase assay solution (Promega) and measuring activity using GloMax luminometer equipment (Promega). For ZsGreen experiments, transfection of tumour cells (CT26 or HEK) was performed with 100 000 tumour cells per well in 200 microlitres of RPMI medium supplemented with 10% FCS and 0.2% antimicrobial reagent Normocin (Invivogen) by adding a mixture of 100 ng of mRNA in 2.5 microlitres of Opti-MEM (Thermo Fisher Scientific) and 200 ng of the lipofectamine transfection reagent MessengerMAX (Thermo Fisher Scientific) in 2.5 microlitres of Opti-MEM to each well. Fluorescence (Excitation: 485nm Emission: 528nm) was recorded in real time at 37°C using Cytation™ 3 Cell Imaging Multi-Mode Reader (BioTek). Immunostimulation experiments were performed by forming protamine-RNA nanoparticles as previously described 15 (mixing RNA at 0.5 mg/ ml in water with protamine at 0.5 mg/ml in water) and incubating them with PBMCs for 20 hours at a final RNA concentration of 5 microgram/ml. Then, the interferon-alpha and tumour necrosis factor (TNF)-alpha contents in the cell culture supernatants were recorded using ELISAs (from Mabtech and eBioscience, respectively).

Animals and في الجسم الحي Imaging

Our study “Anti-cancer therapies based on RNA” was approved by the Veterinary Office of the University of Zurich (Kanton Zürich, Health Direction, Veterinary Office, Zollstrasse 20 8090 Zurich license number ZH215/17). The Veterinary Office of the University of Zurich has a research ethics review committee that granted approval. All efforts were made to minimize suffering. Animals were purchased from Envigo (Netherlands). Mice of 4 to 8 weeks of age were injected intra-venously with 1 microgram of mRNA formulated with a TransIT-mRNA transfection kit following the manufacturer’s suggestions (Mirus). Briefly, per mouse, 1 microgram of mRNA was diluted in 38 microlitres of Opti-MEM (Gibco) before the addition of 0.72 microlitres of “mRNA Boost Reagent”. After mixing, 1.12 microlitres of TransIT reagent was added. The solution was thoroughly homogenated and injected immediately. Five hours later, bioluminescence في الجسم الحي imaging was performed on an IVIS Lumina instrument (PerkinElmer). Immediately before the measurements, D-luciferin (Synchem) dissolved in PBS (15 mg/ml stock) and sterile filtered was injected (150 μg/g intraperitoneally). Emitted photons from live animals were quantified 10-20 minutes post luciferin injections, with an exposure time of 1 min. Regions of interest (ROI) were quantified for average radiance (photons s−1 cm−2 sr−1) (IVIS Living Image 3.2).


مراجع

1. Vinjamur DS, Bauer DE, Orkin SH. Recent progress in understanding and manipulating haemoglobin switching for theopathies. Br J Haematol. (2018) 180:630�. doi: 10.1111/bjh.15038

2. Wienert B, Martyn GE, Funnell APW, Quinlan KGR, Crossley M. Wake-up sleepy gene: reactivating fetal globin for β-hemoglobinopathies. اتجاهات الجينات. (2018) 34:927�. doi: 10.1016/j.tig.2018.09.004

3. Steinberg MH, Rodgers GP. HbA2: biology, clinical relevance and a possible target for ameliorating sickle cell disease. Br J Haematol. (2015) 170:781𠄷. doi: 10.1111/bjh.13570

4. Manchinu MF, Marongiu MF, Poddie D, Casu C, Latini V, Simbula M, et al. في الجسم الحي activation of the human δ-globin gene: the therapeutic potential in β-thalassemic mice. Haematologica. (2014) 99:76�. doi: 10.3324/haematol.2012.082768

5. Danjou F, Zoledziewska M, Sidore C, Steri M, Busonero F, Maschio A, et al. Genome-wide association analyses based on whole-genome sequencing in Sardinia provide insights into regulation of hemoglobin levels. نات جينيه. (2015) 47:1264�. doi: 10.1038/ng.3307

6. Borg J, Papadopoulos P, Georgitsi M, Gutiérrez L, Grech G, Fanis P, et al. Haploinsufficiency for the erythroid transcription factor KLF1 causes hereditary persistence of fetal hemoglobin. نات جينيه. (2010) 42:801𠄵. doi: 10.1038/ng.630

7. Tallack MR, Perkins AC. Three fingers on the switch: krüppel-like factor 1 regulation of γ-globin to β-globin gene switching. Curr Opin Hematol. (2013) 20:193�. doi: 10.1097/MOH.0b013e32835f59ba

8. Wienert B, Martyn GE, Kurita R, Nakamura Y, Quinlan KGR, Crossley M. KLF1 drives the expression of fetal hemoglobin in British HPFH. دم. (2017) 130:803𠄷. doi: 10.1182/blood-2017-02-767400

9. Perseu L, Satta S, Moi P, Demartis FR, Manunza L, Sollaino MC, et al. KLF1 gene mutations cause borderline HbA(2). دم. (2011) 118:4454𠄸. doi: 10.1182/blood-2011-04-345736

10. Porcu S, Manchinu MF, Marongiu MF, Sogos V, Poddie D, Asunis I, et al. Klf1 affects DNase II-alpha expression in the central macrophage of a fetal liver erythroblastic island: a non-cell-autonomous role in definitive erythropoiesis. مول الخلية بيول. (2011) 31:4144�. doi: 10.1128/MCB.05532-11

11. Keyel PA. Dnases in health and disease. Dev Biol. (2017) 429:1�. doi: 10.1016/j.ydbio.2017.06.028

12. Yoshida H, Okabe Y, Kawane K, Fukuyama H, Nagata S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. نات إمونول. (2005) 6:49�.

13. Strouboulis J, Dillon N, Grosveld F. Developmental regulation of a complete 70-kb human beta-globin locus in transgenic mice. تطوير الجينات. (1992) 6:1857�. doi: 10.1101/gad.6.10.1857

14. Weatherall DJ. The inherited diseases of hemoglobin are an emerging global health burden. دم. (2010) 115:4331𠄶. doi: 10.1182/blood-2010-01-251348

15. Thompson AA, Walters MC, Kwiatkowski J, Rasko JEJ, Ribeil JA, Hongeng S, et al. Gene therapy in patients with transfusion-dependent β-thalassemia. إن إنجل جي ميد. (2018) 378:1479�. doi: 10.1056/NEJMoa1705342

16. Cavazzana M, Mavilio F. Gene therapy for hemoglobinopathies. Hum Gene Ther. (2018) 29:1106�. doi: 10.1089/hum.2018.122

17. Modell B, Darlison M. Global epidemiology of haemoglobin disorders and derived services indicators. Bull World Health Organ. (2008) 86:480𠄷. doi: 10.2471/blt.06.036673

18. Piel FB, Hay SI, Gupta S, Weatherall DJ, Williams TN. Global burden of sickle cell anaemia in children under five, 2010-2050: modelling based on demographics, excess mortality, and interventions. بلوس ميد. (2013) 10:e1001484. doi: 10.1371/journal.pmed.1001484

19. Origa R. β-Thalassemia. جينيه ميد. (2017) 19:609�. doi: 10.1038/gim.2016.173

20. Fibach E, Manor D, Oppenheim A, Rachmilewitz EA. Proliferation and maturation of human erythroid progenitors in liquid culture. دم. (1989) 73:100𠄳.

21. Pope SH, Fibach E, Sun J, Chin K, Rodgers GP. Two-phase liquid culture system models normal human adult erythropoiesis at the molecular level. Eur J Haematol. (2000) 64:292�. doi: 10.1034/j.16000609.2000.90032.x

22. Menzel S, Garner C, Rooks H, Spector TD, Thein SL. HbA2 Levels in normal adults are influenced by two distinct mechanisms. Br J Haematol. (2013) 160:101𠄵. doi: 10.1111/bjh.12084

23. Socolovsky M, Murrell M, Liu Y, Pop R, Porpiglia E, Levchenko A. Negative autoregulation by FAS mediates robust fetal erythropoiesis. بلوس بيول. (2007) 5:e252. doi: 10.1371/journal.pbio.0050252

24. Ribeil JA, Arlet JB, Dussiot M, Moura IC, Courtois G, Hermine O. Ineffective erythropoiesis in β-thalassemia. Sci World J. (2013) 2013:394295. doi: 10.1155/2013/394295

25. Gupta R, Musallam KM, Taher AT, Rivella S. Ineffective erythropoiesis: anemia and iron overload. Hematol Oncol Clin North Am. (2018) 32:213�. doi: 10.1016/j.hoc.2017.11.009

26. Ozcan ME, Ince B, Karadeli HH, Gedikbasi A, Asil T, Altinoz MA. Higher minor hemoglobin A2 levels in multiple sclerosis patients correlate with lesser disease severity. Neuropsychiatr Dis Treat. (2016) 1612:2033𠄸. doi: 10.2147/NDT.S109954

27. Palstra RJ, de Laat W, Grosveld F. Beta-globin regulation and long-range interactions. Adv Genet. (2008) 61:107�. doi: 10.1016/S0065-2660(07)00004-1

28. Ross J, Pizarro A. Human beta and delta globin messenger rnas turn over at different rates. J مول بيول. (1983) 167:607�.

29. Runkel L, Meier W, Pepinsky RB, Karpusas M, Whitty A, Kimball K, et al. Structural and functional differences between glycosylated and non-glycosylated forms of human interferon-beta (IFN-beta). Pharm Res. (1998) 15:641𠄹.

30. Durelli L, Verdun E, Barbero P, Bergui M, Versino E, Ghezzi A, et al. Every-other-day interferon beta-1b versus once-weekly interferon beta-1a for multiple sclerosis: results of a 2-year prospective randomised multicentre study (INCOMIN). لانسيت. (2002) 359:1453�. doi: 10.1016/s0140-6736(02)08430-1

31. Rodero MP, Tesser A, Bartok E, Rice GI, Della Mina E, Depp M, et al. Type I interferon-mediated autoinflammation due to DNase II deficiency. نات كومون. (2017) 8:2176. doi: 10.1038/s41467-017-01932-3

32. Paikari A, Sheehan VA. Fetal haemoglobin induction in sickle cell disease. Br J Haematol. (2018) 180:189�. doi: 10.1111/bjh.15021

33. Ristaldi MS, Casula S, Porcu S, Marongiu MF, Pirastu M, Cao A. Activation of the delta-globin gene by the beta-globin gene CACCC motif. Blood Cells Mol Dis. (1999) 25:193�.

34. Powars DR, Weiss JN, Chan LS, Schroeder WA. Is there a threshold level of fetal hemoglobin that ameliorates morbidity in sickle cell anemia?. دم. (1984) 63:921𠄶.

35. Estepp JH, Smeltzer MP, Kang G, Mstats CL, Wang WC, Abrams C, et al. A clinically meaningful fetal hemoglobin threshold for children with sickle cell anemia during hydroxyurea therapy. Am J Hematol. (2017) 92:1333𠄹. doi: 10.1002/ajh.24906

36. Testa U. Apoptotic mechanisms in the control of erythropoiesis. Leukemia. (2004) 18:1176-99. doi: 10.1038/sj.leu.2403383

37. Sarvothaman S, Undi RB, Pasupuleti SR, Gutti U, Gutti RK. Apoptosis: role in myeloid cell development. Blood Res. (2015) 50:73𠄹. doi: 10.5045/br.2015.50.2.73

38. Manchinu MF, Brancia C, Caria CA, Musu E, Porcu S, Simbula M, et al. Deficiency in interferon type 1 receptor improves definitive erythropoiesis in Klf1 null mice. Cell Death Differ. (2018) 25:589�. doi: 10.1038/s41418-017-0003-5

39. Means RT Jr, Krantz SB. Inhibition of human erythroid colony-forming units by tumor necrosis factor requires beta interferon. ياء كلين إنفست. (1993) 91:416𠄹.

40. Means RT Jr, Krantz SB. Inhibition of human erythroid colony-forming units by interferons alpha and beta: differing mechanisms despite shared receptor. إكسب هيماتول. (1996) 24:204𠄸.

41. Sankaran VG, Ludwig LS, Sicinska E, Xu J, Bauer DE, Eng JC, et al. Cyclin D3 coordinates the cell cycle during differentiation to regulate erythrocyte size and number. تطوير الجينات. (2012) 26:2075�. doi: 10.1101/gad.197020

Keywords: erythropoiesis, δ-globin gene, interferon type 1, beta thalassemia, sickle cell anemia

Citation: Manchinu MF, Simbula M, Caria CA, Musu E, Perseu L, Porcu S, Steri M, Poddie D, Frau J, Cocco E, Manunza L, Barella S and Ristaldi MS (2020) Delta-Globin Gene Expression Is Enhanced في الجسم الحي by Interferon Type I. أمام. ميد. 7:163. doi: 10.3389/fmed.2020.00163

Received: 28 January 2020 Accepted: 09 April 2020
Published: 22 May 2020.

Richard Van Wijk, Utrecht University, Netherlands

Cornelis Harteveld, Leiden University Medical Center, Netherlands
Emile Van Den Akker, Sanquin Diagnostic Services, Netherlands

Copyright © 2020 Manchinu, Simbula, Caria, Musu, Perseu, Porcu, Steri, Poddie, Frau, Cocco, Manunza, Barella and Ristaldi. هذا مقال مفتوح الوصول يتم توزيعه بموجب شروط ترخيص Creative Commons Attribution License (CC BY). يُسمح بالاستخدام أو التوزيع أو الاستنساخ في منتديات أخرى ، بشرط أن يُنسب الفضل إلى المؤلف (المؤلفين) الأصليين ومالك (مالكي) حقوق الطبع والنشر وأن يتم الاستشهاد بالمنشور الأصلي في هذه المجلة ، وفقًا للممارسات الأكاديمية المقبولة. لا يُسمح بأي استخدام أو توزيع أو إعادة إنتاج لا يتوافق مع هذه الشروط.